circad | circRNAs associated with diseases

hsa_circ_0014243
Gene	CHTOP	Organism	Human
Genome Locus	chr1:153606457-153618782:+	Build	hg19
Disease	Hypertension	ICD-10	Essential (primary) hypertension (I10)
DBLink	Link to database	PMID	30783441
Experimental Method
Sample Type	Tissue and cell lines	Comparison	78 subjects, comprising 89 healthy controls and 89 patients diagnosed with EH
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACGAACTGCTGGAAGAGGTC Reverse GCAATTACGTCAGGCGTCAG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Zheng, S, Gu, T, Bao, X, Sun, J, Zhao, J, Zhang, T, Zhang, L (2019). Circular RNA hsa_circ_0014243 may serve as a diagnostic biomarker for essential hypertension. Exp Ther Med, 17, 3:1728-1736.